NFI nomenclature for forensic DNA becomes worldwide standard
The international forensic community has decided that the software developed by the NFI to name forensic DNA fragments is to become the new standard. This has been announced by the International Society for Forensic Genetics (ISFG) in a scientific article. This means that virtually all forensic institutes in the world will start using the method devised by DNA researchers at the NFI. “This standard will make it easier for us to exchange and compare data, which in turn will contribute to international cooperation in tracking down criminals”, says NFI researcher Jerry Hoogenboom.
Hoogenboom developed the nomenclature together with his colleague Kris van der Gaag. Hoogenboom wrote the software to process the nomenclature, which is used to name DNA fragments obtained using the advanced approach to DNA sequencing called Massively Parallel Sequencing (MPS). This method provides much more detailed and comprehensive information than the existing standard method, which only measures the length at 23 points in our DNA.
Desire for international standard
DNA specialists discussed the need for uniform nomenclature during an international conference back in 2015. “By then, we had been coming up against the limitations of the different names used by different countries for some time, which makes the international exchange of DNA profiles more complicated”, says van der Gaag, who at the time was involved in his role as a researcher at the Leiden University Medical Center (LUMC). Shortly after, he laid the foundations for the nomenclature, together with his then colleagues Rick de Leeuw and Professor Peter de Knijff of the LUMC. Over the following years, with input from the international forensic community, it was further elaborated and developed by the NFI into ‘STRNaming’. In 2019, Hoogenboom and Van der Gaag presented a prototype of the software. In early 2021, the new nomenclature was presented in a scientific article. The NFI wrote a press release about it. The software was made open source and offered to all countries for free. Following international consultation, the board of the ISFG has now recommended, in a scientific article, that all countries use the NFI nomenclature. In practice, this means that it will become the international standard.
Nomenclature
With the advent of MPS, forensic examiners can establish the exact sequence of building blocks in DNA fragments. The building block sequence is made up of the letters A, T, C and G. The result is a DNA profile consisting of fragments each made up of many hundreds of letters. For example, TATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCAATCAATCATCTATCTATCT. All those letters in a particular sequence provide additional information for minimal or complex trace evidence, for example samples containing the DNA of multiple individuals. Because writing out hundreds of letters again and again involves a lot of work, a shorter name was needed. This can be achieved by placing figures after the letters of the building blocks. The above sequence of building blocks is rendered by the software as CE12_TATC[12]AATC[2]ATCT[3], because the combination TATC occurs twelve times, AATC twice and ATCT three times. CE-12 refers to the name of the DNA fragment in accordance with the existing standard method. Other variations in sequence are also summarised as short suffixes to the name. “They’re not names you can really pronounce, but a human being can understand and dictate them”, says Van der Gaag.
Compact and yet a lot of information
It took a lot of meetings for Van der Gaag and Hoogenboom to convince everyone of the Dutch method. Why was the method devised by the NFI ultimately chosen? Hoogenboom puts it concisely: “Our nomenclature strikes the perfect balance between obtaining and omitting information.” Will the champagne corks be popping? Hoogenboom chuckles and rubs his belly: “There won’t be champagne, but maybe some cake.” Van der Gaag: “We’ve come up with something that has now been accepted by everyone. I’m very proud of that.”
